Instructions to use multimolecule/basset with libraries, inference providers, notebooks, and local apps. Follow these links to get started.
- Libraries
- MultiMolecule
How to use multimolecule/basset with MultiMolecule:
pip install multimolecule
from multimolecule import AutoModel, AutoTokenizer tokenizer = AutoTokenizer.from_pretrained("multimolecule/basset") model = AutoModel.from_pretrained("multimolecule/basset") inputs = tokenizer("ACTCCCCTGCCCTCAACAAGATGTTTTGCCAACTGGCCAAGACCTGCCCTGTGCAGCTGTGGGTTGATTCCACACCCCCGCCCGGCACCCGCGTCCGCGCCATGGCCATCTACAAGCAGTCACAGCACATGACGGAGGTTGTGAGGCGCTGCCCCCACCATGAGCGCTGCTCAGATAGCGATGG", return_tensors="pt") outputs = model(**inputs) embeddings = outputs.last_hidden_state - Notebooks
- Google Colab
- Kaggle
Basset
Deep convolutional neural network for predicting chromatin accessibility (DNase I hypersensitivity) from DNA sequence.
Disclaimer
This is an UNOFFICIAL implementation of Basset: learning the regulatory code of the accessible genome with deep convolutional neural networks by David R. Kelley, et al.
The OFFICIAL repository of Basset is at davek44/Basset.
The MultiMolecule team has confirmed that the provided model and checkpoints are producing the same intermediate representations as the original implementation.
The team releasing Basset did not write this model card for this model so this model card has been written by the MultiMolecule team.
Model Details
Basset is a convolutional neural network (CNN) trained to predict the chromatin accessibility (DNase I hypersensitivity) of a DNA sequence across 164 cell types. The model consumes a fixed-length 600 bp one-hot encoded DNA sequence and applies three convolutional blocks (convolution, batch normalization, ReLU, and max pooling) followed by two fully-connected blocks before a multi-label binary classification head. Please refer to the Training Details section for more information on the training process.
Model Specification
| Num Conv Layers | Num FC Layers | Hidden Size | Num Parameters (M) | FLOPs (G) | MACs (G) | Max Num Tokens |
|---|---|---|---|---|---|---|
| 3 | 2 | 1000 | 4.14 | 0.30 | 0.15 | 600 |
Links
- Code: multimolecule.basset
- Data: ENCODE and Roadmap Epigenomics DNase-seq accessibility compendium across 164 cell types
- Paper: Basset: learning the regulatory code of the accessible genome with deep convolutional neural networks
- Developed by: David R. Kelley, Jasper Snoek, John L. Rinn
- Model type: Three-layer 1D CNN over 600 bp DNA for multi-task chromatin-accessibility prediction
- Original Repository: davek44/Basset
Usage
The model file depends on the multimolecule library. You can install it using pip:
pip install multimolecule
Direct Use
Chromatin Accessibility Prediction
You can use this model directly to predict the DNase I hypersensitivity of a DNA sequence:
>>> import torch
>>> from multimolecule import DnaTokenizer, BassetForSequencePrediction
>>> tokenizer = DnaTokenizer.from_pretrained("multimolecule/basset")
>>> model = BassetForSequencePrediction.from_pretrained("multimolecule/basset")
>>> input = tokenizer("ACGT" * 150, return_tensors="pt")
>>> output = model(**input)
>>> output.logits.shape
torch.Size([1, 164])
Interface
- Input length: fixed 600 bp DNA window
- Output: 164 per-cell-type accessibility logits (multi-label binary)
Training Details
Basset was trained to predict the chromatin accessibility of DNA sequences across a panel of cell types.
Training Data
Basset was trained on DNase I hypersensitivity peaks from ENCODE and the Roadmap Epigenomics project, covering 164 cell types. Each 600 bp genomic interval is labeled with a binary vector indicating which of the 164 cell types show an accessibility peak overlapping that interval.
Training Procedure
Pre-training
The model was trained to minimize a multi-label binary cross-entropy loss, comparing its predicted per-cell-type accessibility probabilities against the observed DNase I hypersensitivity labels.
- Optimizer: RMSprop
- Loss: Multi-label binary cross-entropy
- Regularization: Batch normalization and dropout
Citation
@article{kelley2016basset,
author = {Kelley, David R. and Snoek, Jasper and Rinn, John L.},
title = {Basset: learning the regulatory code of the accessible genome with deep convolutional neural networks},
journal = {Genome Research},
volume = 26,
number = 7,
pages = {990--999},
year = 2016,
publisher = {Cold Spring Harbor Laboratory Press},
doi = {10.1101/gr.200535.115}
}
The artifacts distributed in this repository are part of the MultiMolecule project. If MultiMolecule supports your research, please cite the MultiMolecule project as follows:
@software{chen_2024_12638419,
author = {Chen, Zhiyuan and Zhu, Sophia Y.},
title = {MultiMolecule},
doi = {10.5281/zenodo.12638419},
publisher = {Zenodo},
url = {https://doi.org/10.5281/zenodo.12638419},
year = 2024,
month = may,
day = 4
}
Contact
Please use GitHub issues of MultiMolecule for any questions or comments on the model card.
Please contact the authors of the Basset paper for questions or comments on the paper/model.
License
This model implementation is licensed under the GNU Affero General Public License.
For additional terms and clarifications, please refer to our License FAQ.
SPDX-License-Identifier: AGPL-3.0-or-later
- Downloads last month
- 77