Instructions to use multimolecule/xpresso with libraries, inference providers, notebooks, and local apps. Follow these links to get started.
- Libraries
- MultiMolecule
How to use multimolecule/xpresso with MultiMolecule:
pip install multimolecule
from multimolecule import AutoModel, AutoTokenizer tokenizer = AutoTokenizer.from_pretrained("multimolecule/xpresso") model = AutoModel.from_pretrained("multimolecule/xpresso") inputs = tokenizer("ACTCCCCTGCCCTCAACAAGATGTTTTGCCAACTGGCCAAGACCTGCCCTGTGCAGCTGTGGGTTGATTCCACACCCCCGCCCGGCACCCGCGTCCGCGCCATGGCCATCTACAAGCAGTCACAGCACATGACGGAGGTTGTGAGGCGCTGCCCCCACCATGAGCGCTGCTCAGATAGCGATGG", return_tensors="pt") outputs = model(**inputs) embeddings = outputs.last_hidden_state - Notebooks
- Google Colab
- Kaggle
Xpresso
Deep convolutional neural network for predicting mRNA abundance directly from genomic promoter sequence.
Disclaimer
This is an UNOFFICIAL implementation of Predicting mRNA Abundance Directly from Genomic Sequence Using Deep Convolutional Neural Networks by Vikram Agarwal, et al.
The OFFICIAL repository of Xpresso is at vagarwal87/Xpresso.
The MultiMolecule team has confirmed that the provided model and checkpoints are producing the same intermediate representations as the original implementation.
The team releasing Xpresso did not write this model card for this model so this model card has been written by the MultiMolecule team.
Model Details
Xpresso is a deep convolutional neural network (CNN) that predicts steady-state mRNA expression level directly from genomic sequence. It consumes a promoter window of roughly 10.5 kb centered on the transcription start site (TSS), processes it through a stack of 1D convolution + max-pooling blocks, flattens the result, concatenates a small set of auxiliary numeric mRNA half-life features, and passes the combined representation through fully-connected layers to predict a single scalar expression value. Please refer to the Training Details section for more information on the training process.
Model Specification
| Input Length | Conv Blocks | Hidden Size | Auxiliary Features | Num Parameters (M) | FLOPs (G) | MACs (G) | Max Num Tokens |
|---|---|---|---|---|---|---|---|
| 10,500 | 2 | 2 | 6 | 0.11 | 0.11 | 0.05 | 10,500 |
Links
- Code: multimolecule.xpresso
- Data: Roadmap Epigenomics gene-expression data with promoter sequence and mRNA half-life features
- Paper: Predicting mRNA Abundance Directly from Genomic Sequence Using Deep Convolutional Neural Networks
- Developed by: Vikram Agarwal, Jay Shendure
- Model type: 1D CNN over promoter DNA combined with auxiliary mRNA half-life features for mRNA-abundance regression
- Original Repository: vagarwal87/Xpresso
Usage
The model file depends on the multimolecule library. You can install it using pip:
pip install multimolecule
Direct Use
mRNA Expression Prediction
You can use this model directly to predict the mRNA expression of a promoter sequence together with its auxiliary mRNA half-life features:
>>> import torch
>>> from multimolecule import DnaTokenizer, XpressoForSequencePrediction
>>> tokenizer = DnaTokenizer.from_pretrained("multimolecule/xpresso")
>>> model = XpressoForSequencePrediction.from_pretrained("multimolecule/xpresso")
>>> input = tokenizer("ACGTACGTACGTACGT", return_tensors="pt")
>>> features = torch.randn(1, model.config.num_features)
>>> output = model(**input, features=features)
>>> output.logits.shape
torch.Size([1, 1])
The auxiliary half-life features are passed through the features argument as a float tensor of shape (batch_size, num_features). Models configured with a non-zero num_features require this tensor; models configured with num_features=0 do not accept it.
Interface
- Input length: fixed 10,500 bp promoter window centered on the TSS
- Padding: shorter inputs right-padded; longer inputs center-cropped to
input_length - Auxiliary inputs:
featurestensor of shape(batch_size, num_features)required whennum_features > 0; not accepted whennum_features = 0 - Output: scalar mRNA expression
Training Details
Xpresso was trained to predict steady-state mRNA expression levels (median across tissues/cell lines) from genomic promoter sequence.
Training Data
Xpresso was trained on human and mouse genes, using promoter sequences (~10.5 kb windows centered on the TSS) together with mRNA half-life features derived from gene-body and UTR properties. Expression targets are log-transformed median mRNA levels across tissues.
The Xpresso model follows the published humanMedian configuration.
Training Procedure
Pre-training
The model was trained to minimize a mean-squared-error loss between predicted and observed log mRNA expression values.
- Optimizer: Adam
- Loss: Mean squared error
Citation
@article{agarwal2020predicting,
author = {Agarwal, Vikram and Shendure, Jay},
journal = {Cell Reports},
number = 7,
pages = {107663},
publisher = {Elsevier BV},
title = {Predicting mRNA Abundance Directly from Genomic Sequence Using Deep Convolutional Neural Networks},
volume = 31,
year = 2020,
doi = {10.1016/j.celrep.2020.107663}
}
The artifacts distributed in this repository are part of the MultiMolecule project. If MultiMolecule supports your research, please cite the MultiMolecule project as follows:
@software{chen_2024_12638419,
author = {Chen, Zhiyuan and Zhu, Sophia Y.},
title = {MultiMolecule},
doi = {10.5281/zenodo.12638419},
publisher = {Zenodo},
url = {https://doi.org/10.5281/zenodo.12638419},
year = 2024,
month = may,
day = 4
}
Contact
Please use GitHub issues of MultiMolecule for any questions or comments on the model card.
Please contact the authors of the Xpresso paper for questions or comments on the paper/model.
License
This model implementation is licensed under the GNU Affero General Public License.
For additional terms and clarifications, please refer to our License FAQ.
SPDX-License-Identifier: AGPL-3.0-or-later
- Downloads last month
- 67